GNB5 ORF clone

Services

Gene ID: 10681

Synonym(s): GB5, gbeta5, HG2E, IDDCA, LADCI, LDMLS1, LDMLS2

Description: Heterotrimeric guanine nucleotide-binding proteins (G proteins), which integrate signals between receptors and effector proteins, are composed of an alpha, a beta, and a gamma subunit. These subunits are encoded by families of related genes. This gene encodes a beta subunit. Beta subunits are important regulators of alpha subunits, as well as of certain signal transduction receptors and effectors. Alternatively spliced transcript variants encoding different isoforms exist. [provided by RefSeq, Jul 2008].

This ORF sequence encodes a protein that is exactly the same as the protein of NM_006578.

Product Details

Clone Vector	pCT-AAV-CMV-MCS vector
Species	Human
Promotor for Target Gene	CMV
Target Gene Name	GNB5
Target Gene Position	Inserted between PacI and AscI
ORF Length	1062
Protein Length	353
Native Stop Codon	True
ORF Sequence	atggcaaccgaggggctgcacgagaacgagacgctggcgtcgctgaagagcgaggccgagagcctcaagggcaagctggaggaggagcgagccaagctgcacgatgtggagctgcaccaggtggcggagcgggtggaggccctggggcagtttgtcatgaagaccagaaggaccctcaaaggccacgggaacaaagtcctgtgcatggactggtgcaaagataagaggaggatcgtgagctcgtcacaggatgggaaggtgatcgtgtgggattccttcaccacaaacaaggagcacgcggtcaccatgccctgcacgtgggtgatggcatgtgcttatgccccatcgggatgtgccattgcttgtggtggtttggataataagtgttctgtgtaccccttgacgtttgacaaaaatgaaaacatggctgccaaaaagaagtctgttgctatgcacaccaactacctgtcggcctgcagcttcaccaactctgacatgcagatcctgacagcgagcggcgatggcacatgtgccctgtgggacgtggagagcgggcagctgctgcagagcttccacggacatggggctgacgtcctctgcttggacctggccccctcagaaactggaaacaccttcgtgtctgggggatgtgacaagaaagccatggtgtgggacatgcgctccggccagtgcgtgcaggcctttgaaacacatgaatctgacatcaacagtgtccggtactaccccagtggagatgcctttgcttcagggtcagatgacgctacgtgtcgcctctatgacctgcgggcagatagggaggttgccatctattccaaagaaagcatcatatttggagcatccagcgtggacttctccctcagtggtcgcctgctgtttgctggatacaatgattacactatcaacgtctgggatgttctcaaagggtcccgggtctccatcctgtttggacatgaaaaccgcgttagcactctacgagtttcccccgatgggactgctttctgctctggatcatgggatcataccctcagagtctgggcctaa
Protein Sequence	MATEGLHENETLASLKSEAESLKGKLEEERAKLHDVELHQVAERVEALGQFVMKTRRTLKGHGNKVLCMDWCKDKRRIVSSSQDGKVIVWDSFTTNKEHAVTMPCTWVMACAYAPSGCAIACGGLDNKCSVYPLTFDKNENMAAKKKSVAMHTNYLSACSFTNSDMQILTASGDGTCALWDVESGQLLQSFHGHGADVLCLDLAPSETGNTFVSGGCDKKAMVWDMRSGQCVQAFETHESDINSVRYYPSGDAFASGSDDATCRLYDLRADREVAIYSKESIIFGASSVDFSLSGRLLFAGYNDYTINVWDVLKGSRVSILFGHENRVSTLRVSPDGTAFCSGSWDHTLRVWA
Functional Site/Region	None

Serotype	Targeting Tissues
1	Central Nervous System, Heart, Retinal Pigment Epithelium, Skeletal Muscle
2	Central Nervous System, Kidney, Photoreceptor Cells, Retinal Pigment Epithelium
5	Central Nervous System, Lung, Photoreceptor Cells, Retinal Pigment Epithelium
7	Liver, Skeletal Muscle
8	Central Nervous System, Heart, Liver, Pancreas, Photoreceptor Cells, Retinal Pigment Epithelium
9	Central Nervous System, Heart, Liver, Lung, Skeletal Muscle
RH10	Central Nervous System, Liver, Skeletal Muscle, Lung

User Instructions | pCT-AAV-CMV-ORF Vector Map | Materials Safety Data Sheet

Catalog Number	Product	Size	Price	Qty
ET-101912-AAV-1-50	GNB5 rAAV Virus Particles (Serotype 1)	2x25 ul per vial, 1x10^12 gc/ml	Price: $700.00	Quantity
ET-101912-AAV-1-200	GNB5 rAAV Virus Particles (Serotype 1)	8x25 ul per vial, 1x10^12 gc/ml	Price: $1,200.00	Quantity
ET-101912-AAV-2-50	GNB5 rAAV Virus Particles (Serotype 2)	2x25 ul per vial, 1x10^12 gc/ml	Price: $700.00	Quantity
ET-101912-AAV-2-200	GNB5 rAAV Virus Particles (Serotype 2)	8x25 ul per vial, 1x10^12 gc/ml	Price: $1,200.00	Quantity
ET-101912-AAV-5-50	GNB5 rAAV Virus Particles (Serotype 5)	2x25 ul per vial, 1x10^12 gc/ml	Price: $700.00	Quantity
ET-101912-AAV-5-200	GNB5 rAAV Virus Particles (Serotype 5)	8x25 ul per vial, 1x10^12 gc/ml	Price: $1,200.00	Quantity
ET-101912-AAV-7-50	GNB5 rAAV Virus Particles (Serotype 7)	2x25 ul per vial, 1x10^12 gc/ml	Price: $700.00	Quantity
ET-101912-AAV-7-200	GNB5 rAAV Virus Particles (Serotype 7)	8x25 ul per vial, 1x10^12 gc/ml	Price: $1,200.00	Quantity
ET-101912-AAV-8-50	GNB5 rAAV Virus Particles (Serotype 8)	2x25 ul per vial, 1x10^12 gc/ml	Price: $700.00	Quantity
ET-101912-AAV-8-200	GNB5 rAAV Virus Particles (Serotype 8)	8x25 ul per vial, 1x10^12 gc/ml	Price: $1,200.00	Quantity
ET-101912-AAV-9-50	GNB5 rAAV Virus Particles (Serotype 9)	2x25 ul per vial, 1x10^12 gc/ml	Price: $700.00	Quantity
ET-101912-AAV-9-200	GNB5 rAAV Virus Particles (Serotype 9)	8x25 ul per vial, 1x10^12 gc/ml	Price: $1,200.00	Quantity
ET-101912-AAV-RH10-50	GNB5 rAAV Virus Particles (Serotype RH10)	2x25 ul per vial, 1x10^12 gc/ml	Price: $700.00	Quantity
ET-101912-AAV-RH10-200	GNB5 rAAV Virus Particles (Serotype RH10)	8x25 ul per vial, 1x10^12 gc/ml	Price: $1,200.00	Quantity
ET-101912-AAV-pd	GNB5 pAAV-CMV-ORF TRANSFER VECTOR (Plasmid), Glycerol Stock	1 vial	Price: $1,200.00	Quantity

Products

Services

GNB5 Full-Length ORF: Human Gene AAV Virus

Shopping Cart: 0 Items

Your Wishlist: 0 Items